Restriction Digest

Cleave DNA sequences with one, two, or three restriction enzymes.

Tool Configuration

Configure the parameters for Restriction Digest

DNA Sequences*

>sample sequence A
ctaaattgtaagcgttaatattttgttaaaattcgcgttaaatttttgttaaatcagctcattttttaaccaataggccgaaatcggcaaaatcccttataaatcaaaagaatagaccgagatagggttgagtgttgttccagtttggaacaagagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaaccgtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagttttttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcgtaatacgactcactatagggcgaattggagctccaccgcggtggcggccgctctagaactagtggatcccccgggctgcaggaattcgatatcaagcttatcgataccgtcgacctcgagggggggcccggtacccagcttttgttccctttagtgagggttaattgcgcgcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccac

Paste one or more FASTA sequences (max 100,000,000 characters).

Molecule Topology*

Treat sequences as linear or circular molecules.

First Enzyme*

Select first restriction enzyme.

Second Enzyme

Select second restriction enzyme (optional).

Third Enzyme

Select third restriction enzyme (optional).

Paste DNA Sequences

Enter one or more DNA sequences in FASTA format (up to 100 million characters). The tool works with plasmids, PCR products, or any DNA sequence. Non-DNA characters are automatically removed.

Choose Topology

Select "Linear" for PCR products and gene fragments. Select "Circular" for plasmids and vectors to properly handle restriction sites that span the origin point, which is common in plasmid cloning.

Select Restriction Enzymes

Choose 1-3 restriction enzymes from the dropdown menus. The tool performs sequential digestion: first enzyme cuts the sequence, then second enzyme cuts the resulting fragments, and so on. Use multiple enzymes for complex cloning strategies or fragment isolation.

Understand Fragment Naming

Each fragment is labeled with its source sequence and the enzymes that generated it (e.g., "sequence1_EcoRI-BamHI"). This helps track which enzymes created each fragment, essential for planning gel purification and ligation steps.

Analyze Digest Results

Fragments are sorted by size (largest first) for easy comparison with gel electrophoresis results. The output shows fragment length, sequence, and positions. Use this to predict gel band patterns, plan fragment isolation, or verify expected digest outcomes.

Applications and Tips

Common uses include predicting gel band patterns for cloning verification, planning double digests for directional cloning, identifying desired fragments for subcloning, and quality control for plasmid construction. For best results, check that chosen enzymes have compatible buffer conditions in wet lab experiments.

Restriction Enzyme Digestion

Understanding restriction sites and DNA fragmentation.

What is a Restriction Digest?

Restriction enzymes are molecular scissors that cut DNA at specific recognition sequences. A restriction digest is the process of cutting DNA with one or more restriction enzymes to produce fragments of predictable sizes. This is fundamental to molecular cloning, DNA fingerprinting, and genetic analysis.

How It Works

Each restriction enzyme recognizes and cuts DNA at specific sequences (usually 4-8 bp palindromes). This tool:

• Scans your DNA sequence for enzyme recognition sites
• Performs sequential cuts with up to 3 different enzymes
• Sorts resulting fragments by size
• Supports both linear and circular DNA molecules
• Reports fragment positions and origins

Applications

Restriction digests are used for:

• Predicting DNA fragmentation patterns
• Planning molecular cloning strategies
• Creating restriction maps
• DNA fingerprinting and identification
• Quality control in molecular biology