Combine FASTA

Combine multiple FASTA sequence records into a single sequence

Tool Configuration
Configure the parameters for Combine FASTA

Enter multiple FASTA sequences to combine into a single sequence. Non-letter characters will be removed.

1

Prepare Your FASTA Sequences

Paste multiple FASTA format sequences in the input field. Each sequence should start with a header line beginning with '>'

2

Choose Output Format

Select between FASTA format (includes header) or raw sequence only

3

Configure Line Breaks

Optionally format the output with line breaks (60 characters per line) for better readability

4

Execute and Download

Click the "Execute Tool" button to combine your sequences. Download or copy the result when ready

Example Input:

>sequence_1
ACCGACTRM

>sequence_2
GGGGGAAAAATTTTTCCCCC

>sequence_3
ATGCGTACGTACG
Use Cases
Common applications for the Combine FASTA tool

Codon Usage Analysis

Combine multiple sequences to determine the overall codon usage for a collection of genes.

Sequence Concatenation

Join multiple sequence fragments or exons into a single continuous sequence.

Batch Processing

Prepare sequences for tools that accept single sequence input but you need to analyze multiple records.

Genome Assembly

Merge contigs or scaffolds into longer genomic sequences for further analysis.